analysis of kras codon 61 mutation Search Results


99
ATCC mutant ppet 1 cdnas chinese hamster ovary cells
Mutant Ppet 1 Cdnas Chinese Hamster Ovary Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pm09845671-53-6-16?v=ATCC
Average 99 stars, based on 1 article reviews
mutant ppet 1 cdnas chinese hamster ovary cells - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

96
New England Biolabs n209i mutation
( A ) Chromosome 9 mapping location identified by SNP mapping. All affected animals are homozygous for SNPs derived from the C57BL/6J founder between the proximal end and 46.53 Mb. ( B ) Sanger sequencing confirmation of an A to T transversion at Position 916 of Ecsit . ( C ) Heart weights from wild type ( n = 8), heterozygous <t>N209I</t> mutant ( n = 16), heterozygous knockout ( n = 16), and compound heterozygote animals ( n = 17) confirm that the loss of ECSIT protein function is causative of the hypertrophy phenotype observed. ( D ) Absolute and ( E ) Normalized heart weights from wild type, heterozygous N209I mutant, heterozygous knockout, and compound heterozygote animals. One-way ANOVA with Tukey’s multiple comparisons. Mean ± SEM, **** P < 0.0001.
N209i Mutation, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc10578914-138-8-2?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
n209i mutation - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

86
Jackson Laboratory rara1 deletion mutant mice
( A ) Chromosome 9 mapping location identified by SNP mapping. All affected animals are homozygous for SNPs derived from the C57BL/6J founder between the proximal end and 46.53 Mb. ( B ) Sanger sequencing confirmation of an A to T transversion at Position 916 of Ecsit . ( C ) Heart weights from wild type ( n = 8), heterozygous <t>N209I</t> mutant ( n = 16), heterozygous knockout ( n = 16), and compound heterozygote animals ( n = 17) confirm that the loss of ECSIT protein function is causative of the hypertrophy phenotype observed. ( D ) Absolute and ( E ) Normalized heart weights from wild type, heterozygous N209I mutant, heterozygous knockout, and compound heterozygote animals. One-way ANOVA with Tukey’s multiple comparisons. Mean ± SEM, **** P < 0.0001.
Rara1 Deletion Mutant Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc10552917-526-0-9?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
rara1 deletion mutant mice - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
SoftGenetics mutation surveyor v2.61
( A ) Chromosome 9 mapping location identified by SNP mapping. All affected animals are homozygous for SNPs derived from the C57BL/6J founder between the proximal end and 46.53 Mb. ( B ) Sanger sequencing confirmation of an A to T transversion at Position 916 of Ecsit . ( C ) Heart weights from wild type ( n = 8), heterozygous <t>N209I</t> mutant ( n = 16), heterozygous knockout ( n = 16), and compound heterozygote animals ( n = 17) confirm that the loss of ECSIT protein function is causative of the hypertrophy phenotype observed. ( D ) Absolute and ( E ) Normalized heart weights from wild type, heterozygous N209I mutant, heterozygous knockout, and compound heterozygote animals. One-way ANOVA with Tukey’s multiple comparisons. Mean ± SEM, **** P < 0.0001.
Mutation Surveyor V2.61, supplied by SoftGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc07611803-171-25-28?v=SoftGenetics
Average 90 stars, based on 1 article reviews
mutation surveyor v2.61 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
SoftGenetics mutation surveyor dna 2.61
LDM was used to collect epidermal keratinocytes from areas with altered or normal DEJ morphology. (A) Partial sequence of FERMT1 exon 4 in lymphocytes of P1 showed the duplicating insertion in adenine repeats c.456dupA (A7). The control had the adenine repeat sequence A6. (B) In affected skin sample P1-1, <t>the</t> <t>mutation</t> was found in a homozygous state. Analysis of <t>DNA</t> from microdissected areas (insets) of P1-3 from unaffected skin revealed the mutation in a heterozygous state (A6/7) in the majority of the experiments, but the wild-type sequence (A6) was also found. The sequence in the vicinity of the revertant mutation is shown below; bold denotes the GA6-A6G motif, underline denotes a DNA-polymerase β frameshift hotspot; red denotes the mutation. (C) Partial sequence of FERMT1 exon 5 in lymphocytes of P2 and a control showing the duplicating insertion in a cytosine tract (C8). (D) The homozygous duplication c.676dupC was disclosed in the affected skin P2-1, whereas analysis of DNA from microdissected areas (insets) in unaffected skin P2-2 disclosed the mutation in a heterozygous state (C7/8), or the normal sequence (C7). The sequence in the vicinity of the revertant mutation is shown below; bold denotes the AC6-C6A motif, underline denotes the vertebrate topoisomerase II consensus cleavage site; red denotes the mutation. Scale bars: 50 μm.
Mutation Surveyor Dna 2.61, supplied by SoftGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc03336993-132-13-17?v=SoftGenetics
Average 90 stars, based on 1 article reviews
mutation surveyor dna 2.61 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

92
ATCC δ ald strain msmeg 2659
Bacterial strains and plasmids used in this study
δ Ald Strain Msmeg 2659, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc06018359-444-73-53?v=ATCC
Average 92 stars, based on 1 article reviews
δ ald strain msmeg 2659 - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
SoftGenetics mutation surveyortm dna variant analysis software version 2.61
Bacterial strains and plasmids used in this study
Mutation Surveyortm Dna Variant Analysis Software Version 2.61, supplied by SoftGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc02377272-159-4-12?v=SoftGenetics
Average 90 stars, based on 1 article reviews
mutation surveyortm dna variant analysis software version 2.61 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

92
ATCC mutant p aeruginosa k 799 61
Bacterial strains and plasmids used in this study
Mutant P Aeruginosa K 799 61, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/10__1128_slash_aac__18__1__94-19-11-7?v=ATCC
Average 92 stars, based on 1 article reviews
mutant p aeruginosa k 799 61 - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

94
ATCC prototroph 6 atcc 35151 p aeruginosa z61 mutant 61
Bacterial strains and plasmids used in this study
Prototroph 6 Atcc 35151 P Aeruginosa Z61 Mutant 61, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pm29243909__id7b00214_si_001-35-24-26?v=ATCC
Average 94 stars, based on 1 article reviews
prototroph 6 atcc 35151 p aeruginosa z61 mutant 61 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

99
Thermo Fisher ppd77d34
Bacterial strains and plasmids used in this study
Ppd77d34, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/us08129511-982-197-299?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
ppd77d34 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

90
ZIRC Inc mutant cenpf sa12296
Bacterial strains and plasmids used in this study
Mutant Cenpf Sa12296, supplied by ZIRC Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc10108034-171-20-36?v=ZIRC+Inc
Average 90 stars, based on 1 article reviews
mutant cenpf sa12296 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
SoftGenetics mutation explorer v2.61
Bacterial strains and plasmids used in this study
Mutation Explorer V2.61, supplied by SoftGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/analysis+of+kras+codon+61+mutation/pmc03655323-109-4-7?v=SoftGenetics
Average 90 stars, based on 1 article reviews
mutation explorer v2.61 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Chromosome 9 mapping location identified by SNP mapping. All affected animals are homozygous for SNPs derived from the C57BL/6J founder between the proximal end and 46.53 Mb. ( B ) Sanger sequencing confirmation of an A to T transversion at Position 916 of Ecsit . ( C ) Heart weights from wild type ( n = 8), heterozygous N209I mutant ( n = 16), heterozygous knockout ( n = 16), and compound heterozygote animals ( n = 17) confirm that the loss of ECSIT protein function is causative of the hypertrophy phenotype observed. ( D ) Absolute and ( E ) Normalized heart weights from wild type, heterozygous N209I mutant, heterozygous knockout, and compound heterozygote animals. One-way ANOVA with Tukey’s multiple comparisons. Mean ± SEM, **** P < 0.0001.

Journal: Cardiovascular Research

Article Title: Tissue-specific differences in the assembly of mitochondrial Complex I are revealed by a novel ENU mutation in ECSIT

doi: 10.1093/cvr/cvad101

Figure Lengend Snippet: ( A ) Chromosome 9 mapping location identified by SNP mapping. All affected animals are homozygous for SNPs derived from the C57BL/6J founder between the proximal end and 46.53 Mb. ( B ) Sanger sequencing confirmation of an A to T transversion at Position 916 of Ecsit . ( C ) Heart weights from wild type ( n = 8), heterozygous N209I mutant ( n = 16), heterozygous knockout ( n = 16), and compound heterozygote animals ( n = 17) confirm that the loss of ECSIT protein function is causative of the hypertrophy phenotype observed. ( D ) Absolute and ( E ) Normalized heart weights from wild type, heterozygous N209I mutant, heterozygous knockout, and compound heterozygote animals. One-way ANOVA with Tukey’s multiple comparisons. Mean ± SEM, **** P < 0.0001.

Article Snippet: Site-directed mutagenesis (Q5-SDM—NEB) was utilized to introduce the N209I mutation (Forward—CGATTCAAGATTATCAACCCCTAC—Tm 62.1°C, Reverse—GGTGAACCACAGCTTCATC—Tm 61.5°C, expected amplicon size 7595 bp).

Techniques: Derivative Assay, Sequencing, Mutagenesis, Knock-Out

( A ) Histology of wild-type and Ecsit N209I/N209I ( n = 23) hearts demonstrating overall size increase as well as disorganized, enlarged, and vacuolated cardiomyocytes, indicative of HCM. ( B ) Absolute and normalized (to femur length) weights of heart, lung, and liver in backcrossed animals demonstrating phenotype is still present and that congestion is primarily of the left heart ( n = 22 and 24, unpaired t -test). ( C ) Kaplan–Meier survival plot of wild-type and Ecsit N209I/N209I animals up to 12 weeks of age demonstrating a significant mortality in mutant animals (∼30%) by 12 weeks of age. ( D ) M-mode measurements of echocardiography showing significant enlargement of anterior and posterior wall as well as an increase in ventricular volume and mass. Furthermore, key measurements of cardiac function, stroke volume, ejection fraction, and cardiac output are significantly reduced ( n = 13 and 18, unpaired t -test OR unpaired t -test with Welch’s correction—LVAW;d, LVvol;s, LVmass). Mean ± SEM, ** P < 0.01, **** P < 0.0001.

Journal: Cardiovascular Research

Article Title: Tissue-specific differences in the assembly of mitochondrial Complex I are revealed by a novel ENU mutation in ECSIT

doi: 10.1093/cvr/cvad101

Figure Lengend Snippet: ( A ) Histology of wild-type and Ecsit N209I/N209I ( n = 23) hearts demonstrating overall size increase as well as disorganized, enlarged, and vacuolated cardiomyocytes, indicative of HCM. ( B ) Absolute and normalized (to femur length) weights of heart, lung, and liver in backcrossed animals demonstrating phenotype is still present and that congestion is primarily of the left heart ( n = 22 and 24, unpaired t -test). ( C ) Kaplan–Meier survival plot of wild-type and Ecsit N209I/N209I animals up to 12 weeks of age demonstrating a significant mortality in mutant animals (∼30%) by 12 weeks of age. ( D ) M-mode measurements of echocardiography showing significant enlargement of anterior and posterior wall as well as an increase in ventricular volume and mass. Furthermore, key measurements of cardiac function, stroke volume, ejection fraction, and cardiac output are significantly reduced ( n = 13 and 18, unpaired t -test OR unpaired t -test with Welch’s correction—LVAW;d, LVvol;s, LVmass). Mean ± SEM, ** P < 0.01, **** P < 0.0001.

Article Snippet: Site-directed mutagenesis (Q5-SDM—NEB) was utilized to introduce the N209I mutation (Forward—CGATTCAAGATTATCAACCCCTAC—Tm 62.1°C, Reverse—GGTGAACCACAGCTTCATC—Tm 61.5°C, expected amplicon size 7595 bp).

Techniques: Mutagenesis

( A ) Representative cardiac electron transport chain protein levels for each complex (I—NDUFB8, II—SDHA, III—UQCRC2, IV—MTCO1, V—ATP5A) ( n = 6, unpaired t -test). ( B ) Immunoprecipitation of wild-type and mutant ECSIT (His tagged; 45 and 50 kDa) with full-length wild-type TRAF6 (Myc tagged; 60 kDa; green: Myc) and rabbit (red: His). (1) Untransfected input lysate, (2) wild-type ECSIT(His) + wild-type TRAF6(Myc) input lysate, (3) ECSIT N209I(His) + wild-type TRAF6(Myc) input lysate, (4) wild-type ECSIT(His) + wild-type TRAF6(Myc) anti-His immunoprecipitation, (5) empty AC-His vector + wild-type TRAF6(Myc) anti-His immunoprecipitation, (6) wild-type ECSIT(His) + wild-type TRAF6(Myc) anti-Myc immunoprecipitation, (7) wild-type ECSIT(His) + empty entry(Myc) vector anti-Myc immunoprecipitation, (8) N209I ECSIT(His) + wild-type TRAF6(Myc) anti-His immunoprecipitation, (9) Empty AC-His vector + wild-type TRAF6(Myc) anti-His immunoprecipitation, (10) N209I ECSIT(His) + wild-type TRAF6(Myc) anti-Myc immunoprecipitation, (11) N209I ECSIT + empty entry(Myc) vector anti-Myc immunoprecipitation (representative of n = 3 experimental repeats). Mean ± SEM, ** P < 0.01.

Journal: Cardiovascular Research

Article Title: Tissue-specific differences in the assembly of mitochondrial Complex I are revealed by a novel ENU mutation in ECSIT

doi: 10.1093/cvr/cvad101

Figure Lengend Snippet: ( A ) Representative cardiac electron transport chain protein levels for each complex (I—NDUFB8, II—SDHA, III—UQCRC2, IV—MTCO1, V—ATP5A) ( n = 6, unpaired t -test). ( B ) Immunoprecipitation of wild-type and mutant ECSIT (His tagged; 45 and 50 kDa) with full-length wild-type TRAF6 (Myc tagged; 60 kDa; green: Myc) and rabbit (red: His). (1) Untransfected input lysate, (2) wild-type ECSIT(His) + wild-type TRAF6(Myc) input lysate, (3) ECSIT N209I(His) + wild-type TRAF6(Myc) input lysate, (4) wild-type ECSIT(His) + wild-type TRAF6(Myc) anti-His immunoprecipitation, (5) empty AC-His vector + wild-type TRAF6(Myc) anti-His immunoprecipitation, (6) wild-type ECSIT(His) + wild-type TRAF6(Myc) anti-Myc immunoprecipitation, (7) wild-type ECSIT(His) + empty entry(Myc) vector anti-Myc immunoprecipitation, (8) N209I ECSIT(His) + wild-type TRAF6(Myc) anti-His immunoprecipitation, (9) Empty AC-His vector + wild-type TRAF6(Myc) anti-His immunoprecipitation, (10) N209I ECSIT(His) + wild-type TRAF6(Myc) anti-Myc immunoprecipitation, (11) N209I ECSIT + empty entry(Myc) vector anti-Myc immunoprecipitation (representative of n = 3 experimental repeats). Mean ± SEM, ** P < 0.01.

Article Snippet: Site-directed mutagenesis (Q5-SDM—NEB) was utilized to introduce the N209I mutation (Forward—CGATTCAAGATTATCAACCCCTAC—Tm 62.1°C, Reverse—GGTGAACCACAGCTTCATC—Tm 61.5°C, expected amplicon size 7595 bp).

Techniques: Immunoprecipitation, Mutagenesis, Plasmid Preparation

Representative TEM images of wild-type and Ecsit N209I/N209I interfibrillar and perinuclear mitochondria from cardiac tissue demonstrating structural abnormalities observed in Ecsit N209I/N209I samples ( n = 3). Wild-type interfibrillar ( A ) and perinuclear ( B ) mitochondria demonstrate consistent evenly stacked cristae with no signs of disorganization. Mutant interfibrillar mitochondria demonstrate phenotypes such as hyper condensed ( C ) and disorganized cristae ( D ). Perinuclear mitochondria from mutant hearts also demonstrate disorganization ( E and F ), although hyper-packed cristae were not observed. Scale bars = 500 nm. ( G and H ) Measurements of mitochondria demonstrate a significant reduction in cross-sectional area of both interfibrillar and perinuclear mitochondria. ( I–L ) Normalized cardiac COXIV, TOMM20 and PGC1α protein, and mRNA expression demonstrating no differences in inner or outer membrane protein abundance but a decrease of mitochondrial biogenesis pathways at both the mRNA and protein level ( n = 6, unpaired t -test). ( M ) Quantification of mitochondrial and nuclear DNA demonstrate a significant increase in relative amount of mtDNA in Ecsit N209I/N209I heart muscle in comparison with controls ( N–P ) quantification of PINK1 demonstrating an increase in protein levels typically associated with increased mitochondrial degradation and of mitochondrial fusion proteins, OPA1 and MFN2, typically associated with alterations to mitochondrial dynamics and quality control. ( Q ) Cardiac Complex I protein abundance of various proteins representing Complex I subunits and accessory proteins, N (V2), Q (S2, S3, S8), PP (ND1, A8, C2), PD (B11, B3), and the accessory protein NDUFA10. Quantification (normalized to VDAC, relative to wild-type average) shows a significant reduction in protein levels of all except two proteins, NDUFS3 and MT-ND1 ( n = 6, unpaired t -test). Mean ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: Cardiovascular Research

Article Title: Tissue-specific differences in the assembly of mitochondrial Complex I are revealed by a novel ENU mutation in ECSIT

doi: 10.1093/cvr/cvad101

Figure Lengend Snippet: Representative TEM images of wild-type and Ecsit N209I/N209I interfibrillar and perinuclear mitochondria from cardiac tissue demonstrating structural abnormalities observed in Ecsit N209I/N209I samples ( n = 3). Wild-type interfibrillar ( A ) and perinuclear ( B ) mitochondria demonstrate consistent evenly stacked cristae with no signs of disorganization. Mutant interfibrillar mitochondria demonstrate phenotypes such as hyper condensed ( C ) and disorganized cristae ( D ). Perinuclear mitochondria from mutant hearts also demonstrate disorganization ( E and F ), although hyper-packed cristae were not observed. Scale bars = 500 nm. ( G and H ) Measurements of mitochondria demonstrate a significant reduction in cross-sectional area of both interfibrillar and perinuclear mitochondria. ( I–L ) Normalized cardiac COXIV, TOMM20 and PGC1α protein, and mRNA expression demonstrating no differences in inner or outer membrane protein abundance but a decrease of mitochondrial biogenesis pathways at both the mRNA and protein level ( n = 6, unpaired t -test). ( M ) Quantification of mitochondrial and nuclear DNA demonstrate a significant increase in relative amount of mtDNA in Ecsit N209I/N209I heart muscle in comparison with controls ( N–P ) quantification of PINK1 demonstrating an increase in protein levels typically associated with increased mitochondrial degradation and of mitochondrial fusion proteins, OPA1 and MFN2, typically associated with alterations to mitochondrial dynamics and quality control. ( Q ) Cardiac Complex I protein abundance of various proteins representing Complex I subunits and accessory proteins, N (V2), Q (S2, S3, S8), PP (ND1, A8, C2), PD (B11, B3), and the accessory protein NDUFA10. Quantification (normalized to VDAC, relative to wild-type average) shows a significant reduction in protein levels of all except two proteins, NDUFS3 and MT-ND1 ( n = 6, unpaired t -test). Mean ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Site-directed mutagenesis (Q5-SDM—NEB) was utilized to introduce the N209I mutation (Forward—CGATTCAAGATTATCAACCCCTAC—Tm 62.1°C, Reverse—GGTGAACCACAGCTTCATC—Tm 61.5°C, expected amplicon size 7595 bp).

Techniques: Mutagenesis, Expressing, Membrane, Quantitative Proteomics, Comparison, Control

( A ) Brain Complex I protein abundance of various proteins representing Complex I subunits and accessory proteins, N (V2), Q (S2, S3, S8), PP (ND1, A8, C2), PD (B11, B3), and the accessory protein NDUFA10. Quantification (normalized to VDAC, relative to WT average) shows a significant reduction in protein levels of all except four proteins, NDUFV2, NDUFS3, MT-ND1, and NDUFA8. MT-ND1 was not detectable by western blot in brain samples ( n = 6, unpaired t -test). ( B ) In gel activity assay of Complex I in mitochondria isolated from heart and brain tissue of wild-type and Ecsit N209I/N209I animals. Depth of stain corresponds to Complex I activity with deeper staining reflecting greater activity. Results show a reduction in Complex I activity of Ecsit N209I/N209I hearts, while brains show no differences between genotypes ( n = 6). ( C ) Quantification and statistical analysis of Complex I in gel activity in cardiac mitochondria. Analysis confirms the significant reduction in Complex I activity in cardiac mitochondria ( n = 6, unpaired t -test). ( D ) Quantification and statistical analysis of Complex I in gel activity in brain mitochondria. Analysis shows no differences between mitochondria from wild-type and Ecsit N209I/N209I brains ( n = 6, unpaired t -test). ( E ) Seahorse oxygen consumption rate measurements from wild-type and Ecsit N209I/N209I heart and brain mitochondria. Significant differences can be seen between wild-type and Ecsit N209I/N209I heart mitochondria during State III and State IIIu respiration. No differences are seen between wild-type and Ecsit N209I/N209I brain mitochondria ( n = 4, RM one-way ANOVA with Tukey’s multiple comparisons OR Friedman’s test with Dunn’s multiple comparison for State III). Mean ± SEM, * P < 0.05, ** P < 0.01, **** P < 0.0001.

Journal: Cardiovascular Research

Article Title: Tissue-specific differences in the assembly of mitochondrial Complex I are revealed by a novel ENU mutation in ECSIT

doi: 10.1093/cvr/cvad101

Figure Lengend Snippet: ( A ) Brain Complex I protein abundance of various proteins representing Complex I subunits and accessory proteins, N (V2), Q (S2, S3, S8), PP (ND1, A8, C2), PD (B11, B3), and the accessory protein NDUFA10. Quantification (normalized to VDAC, relative to WT average) shows a significant reduction in protein levels of all except four proteins, NDUFV2, NDUFS3, MT-ND1, and NDUFA8. MT-ND1 was not detectable by western blot in brain samples ( n = 6, unpaired t -test). ( B ) In gel activity assay of Complex I in mitochondria isolated from heart and brain tissue of wild-type and Ecsit N209I/N209I animals. Depth of stain corresponds to Complex I activity with deeper staining reflecting greater activity. Results show a reduction in Complex I activity of Ecsit N209I/N209I hearts, while brains show no differences between genotypes ( n = 6). ( C ) Quantification and statistical analysis of Complex I in gel activity in cardiac mitochondria. Analysis confirms the significant reduction in Complex I activity in cardiac mitochondria ( n = 6, unpaired t -test). ( D ) Quantification and statistical analysis of Complex I in gel activity in brain mitochondria. Analysis shows no differences between mitochondria from wild-type and Ecsit N209I/N209I brains ( n = 6, unpaired t -test). ( E ) Seahorse oxygen consumption rate measurements from wild-type and Ecsit N209I/N209I heart and brain mitochondria. Significant differences can be seen between wild-type and Ecsit N209I/N209I heart mitochondria during State III and State IIIu respiration. No differences are seen between wild-type and Ecsit N209I/N209I brain mitochondria ( n = 4, RM one-way ANOVA with Tukey’s multiple comparisons OR Friedman’s test with Dunn’s multiple comparison for State III). Mean ± SEM, * P < 0.05, ** P < 0.01, **** P < 0.0001.

Article Snippet: Site-directed mutagenesis (Q5-SDM—NEB) was utilized to introduce the N209I mutation (Forward—CGATTCAAGATTATCAACCCCTAC—Tm 62.1°C, Reverse—GGTGAACCACAGCTTCATC—Tm 61.5°C, expected amplicon size 7595 bp).

Techniques: Quantitative Proteomics, Western Blot, Activity Assay, Isolation, Staining, Comparison

( A and B ) Cardiac and brain ECSIT protein abundance normalized to loading control VDAC and demonstrated as fold change in comparison with wild-type control. Results show an increase in both 50 and 45 kDa ECSIT protein in Ecsit N209I/N209I animals compared with wild types ( n = 6, unpaired t -test). In contrast, 16 kDa ECSIT demonstrates a significant reduction in Ecsit N209I/N209I animals, to the point where it is essentially undetectable in cardiac tissue from these animals. ( C and D ) Immunoprecipitation of wild-type and mutant ECSIT (His tagged; 45 and 50 kDa) with full-length wild-type NDUFAF1 or ACAD9 (Myc tagged; 60 kDa; green: Myc, red: His). (1) untransfected input lysate, (2) wild-type ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) input lysate, (3) ECSIT N209I(His) + wild-type NDUFAF1/ACAD9(Myc) input lysate, (4) wild-type ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (5) empty AC-His vector + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (6) wild-type ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-Myc immunoprecipitation, (7) wild-type ECSIT(His) + empty entry(Myc) vector anti-Myc immunoprecipitation, (8) N209I ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (9) empty AC-His vector + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (10) N209I ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-Myc immunoprecipitation, (11) N209I ECSIT + empty entry(Myc) vector anti-Myc immunoprecipitation (representative of n = 3 experimental repeats). Mean ± SEM, ** P < 0.01.

Journal: Cardiovascular Research

Article Title: Tissue-specific differences in the assembly of mitochondrial Complex I are revealed by a novel ENU mutation in ECSIT

doi: 10.1093/cvr/cvad101

Figure Lengend Snippet: ( A and B ) Cardiac and brain ECSIT protein abundance normalized to loading control VDAC and demonstrated as fold change in comparison with wild-type control. Results show an increase in both 50 and 45 kDa ECSIT protein in Ecsit N209I/N209I animals compared with wild types ( n = 6, unpaired t -test). In contrast, 16 kDa ECSIT demonstrates a significant reduction in Ecsit N209I/N209I animals, to the point where it is essentially undetectable in cardiac tissue from these animals. ( C and D ) Immunoprecipitation of wild-type and mutant ECSIT (His tagged; 45 and 50 kDa) with full-length wild-type NDUFAF1 or ACAD9 (Myc tagged; 60 kDa; green: Myc, red: His). (1) untransfected input lysate, (2) wild-type ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) input lysate, (3) ECSIT N209I(His) + wild-type NDUFAF1/ACAD9(Myc) input lysate, (4) wild-type ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (5) empty AC-His vector + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (6) wild-type ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-Myc immunoprecipitation, (7) wild-type ECSIT(His) + empty entry(Myc) vector anti-Myc immunoprecipitation, (8) N209I ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (9) empty AC-His vector + wild-type NDUFAF1/ACAD9(Myc) anti-His immunoprecipitation, (10) N209I ECSIT(His) + wild-type NDUFAF1/ACAD9(Myc) anti-Myc immunoprecipitation, (11) N209I ECSIT + empty entry(Myc) vector anti-Myc immunoprecipitation (representative of n = 3 experimental repeats). Mean ± SEM, ** P < 0.01.

Article Snippet: Site-directed mutagenesis (Q5-SDM—NEB) was utilized to introduce the N209I mutation (Forward—CGATTCAAGATTATCAACCCCTAC—Tm 62.1°C, Reverse—GGTGAACCACAGCTTCATC—Tm 61.5°C, expected amplicon size 7595 bp).

Techniques: Quantitative Proteomics, Control, Comparison, Immunoprecipitation, Mutagenesis, Plasmid Preparation

LDM was used to collect epidermal keratinocytes from areas with altered or normal DEJ morphology. (A) Partial sequence of FERMT1 exon 4 in lymphocytes of P1 showed the duplicating insertion in adenine repeats c.456dupA (A7). The control had the adenine repeat sequence A6. (B) In affected skin sample P1-1, the mutation was found in a homozygous state. Analysis of DNA from microdissected areas (insets) of P1-3 from unaffected skin revealed the mutation in a heterozygous state (A6/7) in the majority of the experiments, but the wild-type sequence (A6) was also found. The sequence in the vicinity of the revertant mutation is shown below; bold denotes the GA6-A6G motif, underline denotes a DNA-polymerase β frameshift hotspot; red denotes the mutation. (C) Partial sequence of FERMT1 exon 5 in lymphocytes of P2 and a control showing the duplicating insertion in a cytosine tract (C8). (D) The homozygous duplication c.676dupC was disclosed in the affected skin P2-1, whereas analysis of DNA from microdissected areas (insets) in unaffected skin P2-2 disclosed the mutation in a heterozygous state (C7/8), or the normal sequence (C7). The sequence in the vicinity of the revertant mutation is shown below; bold denotes the AC6-C6A motif, underline denotes the vertebrate topoisomerase II consensus cleavage site; red denotes the mutation. Scale bars: 50 μm.

Journal: The Journal of Clinical Investigation

Article Title: Revertant mosaicism in a human skin fragility disorder results from slipped mispairing and mitotic recombination

doi: 10.1172/JCI61976

Figure Lengend Snippet: LDM was used to collect epidermal keratinocytes from areas with altered or normal DEJ morphology. (A) Partial sequence of FERMT1 exon 4 in lymphocytes of P1 showed the duplicating insertion in adenine repeats c.456dupA (A7). The control had the adenine repeat sequence A6. (B) In affected skin sample P1-1, the mutation was found in a homozygous state. Analysis of DNA from microdissected areas (insets) of P1-3 from unaffected skin revealed the mutation in a heterozygous state (A6/7) in the majority of the experiments, but the wild-type sequence (A6) was also found. The sequence in the vicinity of the revertant mutation is shown below; bold denotes the GA6-A6G motif, underline denotes a DNA-polymerase β frameshift hotspot; red denotes the mutation. (C) Partial sequence of FERMT1 exon 5 in lymphocytes of P2 and a control showing the duplicating insertion in a cytosine tract (C8). (D) The homozygous duplication c.676dupC was disclosed in the affected skin P2-1, whereas analysis of DNA from microdissected areas (insets) in unaffected skin P2-2 disclosed the mutation in a heterozygous state (C7/8), or the normal sequence (C7). The sequence in the vicinity of the revertant mutation is shown below; bold denotes the AC6-C6A motif, underline denotes the vertebrate topoisomerase II consensus cleavage site; red denotes the mutation. Scale bars: 50 μm.

Article Snippet: DNA sequences were compared with the NCBI reference ( {"type":"entrez-nucleotide","attrs":{"text":"NC_000020.10","term_id":"224589812","term_text":"NC_000020.10"}} NC_000020.10 ) using Mutation Surveyor DNA (2.61 Softgenetics).

Techniques: Sequencing, Control, Mutagenesis

Bacterial strains and plasmids used in this study

Journal: Journal of Bacteriology

Article Title: Roles of Alanine Dehydrogenase and Induction of Its Gene in Mycobacterium smegmatis under Respiration-Inhibitory Conditions

doi: 10.1128/JB.00152-18

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: The construction of the mutant strains of M. smegmatis and the plasmids used in this study is described in the supplemental material. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant phenotype or genotype a Reference or source Strains M. smegmatis mc 2 155 High-transformation-efficiency mutant of M. smegmatis ATCC 607 53 Δ aldR strain MSMEG_2660 ( aldR ) deletion mutant derived from M. smegmatis mc 2 155 61 Δ ald strain MSMEG_2659 ( ald ) deletion mutant derived from M. smegmatis mc 2 155 This study Δ bd strain MSMEG_3233 ( cydA ) deletion mutant derived from M. smegmatis mc 2 155 This study Δ aa 3 strain MSMEG_4268 ( ctaC ) deletion mutant derived from M. smegmatis mc 2 155 This study Δ bd Δ ald strain MSMEG_3233 ( cydA ) deletion mutant derived from M. smegmatis Δ ald This study E. coli DH5α ϕ80d lacZ ΔM15 Δ lacU169 recA1 endA1 hsdR17 supE44 thi1 gyrA96 relA1 62 Plasmids pKOTs Hyg r ; pKO-based vector containing a temp-sensitive replication origin (pAL500Ts) and pUC ori 61 pNC Hyg r ; promoterless lacZ 63 pMV306 Km r ; integrative vector containing the int and attP sites of mycobacteriophage L5 for integration into the mycobacterial genome 64 , 65 pNBV1 Hyg r ; 5.8-kb vector derived from p16R1 66 pKOTsΔald pKOTs::0.81-kb BamHI-HindIII fragment containing Δ MSMEG_2659 (Δ ald ) This study pKOTsΔbd pKOTs::0.74-kb NotI-HindIII fragment containing Δ MSMEG_3233 (Δ bd ) This study pKOTsΔaa 3 pKOTs::0.94-kb BamHI-HindIII fragment containing Δ MSMEG_4268 (Δ aa 3 ) This study pALDLACZ pNC::0.52-kb XbaI-ClaI fragment containing the ald promoter region of M. smegmatis mc 2 155 12 pMV306ctaC pMV306 with 1.37-kb XbaI-HindIII fragment containing ctaC of M. smegmatis mc 2 155 This study pMV306ald pMV306 with 1.55-kb XbaI-HindIII fragment containing ald of M. smegmatis mc 2 155 This study pNBV1cydA pNBV1 with 1.92-kb XbaI-HindIII fragment containing cydA of M. smegmatis mc 2 155 This study Open in a separate window a Antibiotic resistance is indicated by abbreviation (Hyg, hygromycin; Km, kanamycin).

Techniques: Plasmid Preparation, Mutagenesis, Derivative Assay